La tunisie Medicale - 2015 ; Vol 93 ( n°07 ) : 445-448
[ Vu 4928 fois ]
Résumé
RESUME
Prérequis : Les dystrophies rétiniennes héréditaires constituent la cause majeure de la cécité et de la malvoyance. La perte visuelle est due à une dégénérescence des cellules de la rétine neurosensorielle et de l’épithélium pigmentaire. Les plus sévères sont l’Amaurose Congénitale de Leber (ACL), la Rétinopathie Pigmentaire (RP) juvénile et à âge de début précoce. L’ACL et la RP juvénile constituent le groupe de «Early Onset Retinal Dystrophy» (EORD).
Objectif : Exploration moléculaire de la R91W (gène RPE65) chez des patients Tunisiens atteints d’EORD et de la RP à âge de début précoce.
Méthodes : Tous nos patients ont bénéficié d’un examen ophtalmologique complet et d’un examen général. La recherche de la R91W a été réalisée par un séquençage direct de l’exon 4 du gène RPE65 et par une digestion enzymatique.
Résultats : Parmi 47 patients, 13 étaient originaires de Nabeul. Vingt-trois avaient une EORD avec une baisse de l’acuité visuelle à un âge de début inférieur à 2 ans. Vingt-quatre autres étaient atteints d’une RP précoce et présentaient cette symptomatologie entre l’âge de 4 et 10 ans. La Meilleure Acuité Visuelle Corrigée
variait entre 2/10 et 1/60. Sur les 94 chromosomes explorés, l’allèle R91W (325C>T) n’a été identifié qu’à l’état hétérozygote chez une fratrie originaire de Nabeul. La fréquence de cet allèle est 2.12% (2/94).
Conclusion : Tous nos patients présentaient des formes sévères avec une dégénérescence rétinienne évoluée. La mutation R91W (325C>T) n’est pas la cause majeure de l’EORD et de la RP à âge de début précoce chez les patients Tunisiens.
Mots Clés
Article

Les dystrophies rétiniennes héréditaires est un groupe hétérogène cliniquement et génétiquement. Ils sont la cause de la perte visuelle suite à une dégénérescence des cellules photo réceptrices et de l’épithélium pigmentaire. L’Amaurose Congénitale de Leber (ACL) est la plus sévère et son âge de début s’étale de la naissance jusqu’aux six premiers mois. La rétinopathie pigmentaire (RP) est moins sévère et se manifeste par une difficulté progressive de la vision nocturne (hespéranopie) et une perte du champ visuel [1,2]. Aux stades avancés, l’acuité visuelle (AV) est sévèrement altérée et se limite généralement à la perception lumineuse. Généralement, le fond d’oeil (FO) est caractéristique par sa triade bilatérale: un rétrécissement artériolaire diffus, une pâleur papillaire et une migration intrarétinienne pigmentée. La prévalence mondiale de la RP non syndromique est estimée à 1 pour 4.000 [3]. La RP est classée selon l’âge de début de la
symptomatologie et sa sévérité. La perte visuelle de la RP juvénile débute entre l’âge de 6 mois et 2 ans avec une évolution rapide vers un champ visuel tubulaire dès l’âge de 6 ans. L’ACL et la RP juvénile constituent la «Early Onset Retinal Dystrophy» (EORD). La RP à début précoce commence par une gêne de la vision nocturne à partir de l’âge de 4 ans [4]. La RP classique commence à la deuxième et à la troisième décade et évolue progressivement. Certaines formes rares, dites séniles débutent après l’âge de 50 ans [5]. L’hétérogénéité clinique de la RP est le résultat d’une hétérogénéité génétique et moléculaire. La transmission de la maladie peut être mendélienne, mitochondriale, digénique ou sporadique. La RP autosomique récessive (RPar) constitue 15 à 20% des RP non syndromiques [6]. Par ailleurs, 41 gènes et 3 loci morbides ont été responsables de la RPar [7]. Parmi les mutations morbides, sont celles rapportées dans le gène RPE65 et sont responsables d’un continuum de phénotype allant de l’ACL/EORD (le plus sévère) (6 à 16%) à la RPar (2.1%) [8,9]. La RPE65 est spécifiquement exprimée dans
l’épithélium pigmentaire. Cette protéine est essentielle pour la régénération de la 11 cis rétinal, nécessaire pour la cascade de la phototransduction [10]. Des essais de thérapie génique ont été réalisés pour la reconstitution de la vision chez la souris, le chien Briad et l’Homme [11-16]. En Tunisie, une étude antérieure a suggéré la présence d’une forme endémique de l’EORD, due à la mutation R91W (c.325C>T) du gène RPE65, chez trois familles consanguines, du Nord Est du pays (Nabeul) [17]. Notre objectif est l’exploration moléculaire de la R91W (gène RPE65) chez des patients Tunisiens atteints d’EORD et de la RP à âge de début précoce.

METHODES
Tous les 47 propositi de 46 familles ont bénéficié d’un examen ophtalmologique complet qui comprenait la mesure de l’AV, un examen à la lampe à fente et un examen du fond d’oeil (FO). Si possible, un champ visuel Goldman (CV), un électrorétinogramme standard (ERG) et un OCT Spectral Domain (SD-OCT) ont été réalisés. Un examen général a été conduit pour la recherche d’atteintes systémiques. Après un consentement éclairé, chaque famille a bénéficié d’une enquête génétique et un prélèvement sanguin pour une extraction de l’ADN à partir du sang total. Une amplification spécifique de l’exon 4 du gène RPE65 a été réalisée par une PCR en utilisant des amorces spécifiques dont la séquence nucléotidique est la suivante, le sens: 5’GTACGGATTGCTCCTGTCTA3’ et l’antisens
5’CCTGAACATCACCTAGCACT3’. Pour la recherche de la mutation R91W (c.325C>T), des réactions de séquençage et de digestion enzymatique ont été réalisées. Le séquençage a été fait avec le kit Big Dye Terminator (Applied Biosystems, Foster City, CA, USA) en utilisant le séquenceur ABI prism 3130 et ceci conformément aux instructions du fabricant. Une étude in silico, avec le logiciel WatCut a montré que la R91W abolit le site de restriction de l’enzyme RSAI. Le volume final de la réaction de la digestion enzymatique est 12.2 μl contenant 1 μl du tampon de l’enzyme (10X), 0.2 unités de l’enzyme RSAI et 6μl de H2O. L’incubation se fait à 37°C pendant une nuit. Les produits de digestion sont ensuite séparés par une électrophorèse sur un gel d’agarose à 3%. La fréquence de l’allèle muté « T » est exprimée en pourcentage et calculée par un simple comptage de cet allèle. Elle est égale à deux fois le nombre de génotypes homozygotes (TT) plus le nombre de
génotypes hétérozyg.

RESULTATS
Nous avons rapporté 47 patients qui appartenaient à 46 familles Tunisiennes. Parmi lesquels, 23 se plaignaient d’une hespéranopie et d’une baisse de l’AV depuis la première enfance (≤ 2 ans) et 24 autres présentaient cette symptomatologie à un âge de début précoce (entre 4 et 10 ans). A la dernière consultation, les âges variaient entre 2 et 55 ans et le sexe ratio était égal à 1.2. La transmission est autosomique récessive chez 25 familles et les 21 autres sont sporadiques. Soixante-seize pourcent des patients étaient issus d’un mariage consanguin. Treize patients (28%) étaient originaires du gouvernorat
de Nabeul, 25 (53.2%) du nord, 5 (10.6%) du centre et 3 (6.9%) du sud de la Tunisie. Chez tous nos patients, la perte de l’AV était bilatérale. A la consultation, les patients atteints de EORD et âgés de 2 à 10 ans avaient une Meilleure Acuité Visuelle Corrigée (MAVC) moyenne de 2/10. La même MAVC moyenne était rapportée chez des patients avec une RP précoce mais âgés plus de 10 ans. A la deuxième décade, la perte de l’AV chez les EORD était progressive et sévère (1/60). Le segment antérieur montrait une cataracte chez 4 patients (8.5%). L’aspect du fond d’oeil était symétrique et bilatéral et montrait une dystrophie rétinienne avec un rétrécissement vasculaire, une pâleur papillaire, une atrophie rétinienne surtout en périphérie associée ou non à des migrations pigmentaires. Parmi les 12 patients qui ne présentaient pas de pigments, 7 (58.3%) étaient âgés moins de 10 ans à la consultation. Toutefois, des hyperpigmentations en forme de mottes ou d’ostéoblastes se manifestaient de plus en plus à partir de la deuxième décade et sont présentes chez 19 parmi 21 patients (90%) (Figure 1). Les pigments rétiniens se répartissaient soit sur les 4 quadrants et autour des vaisseaux soit sur toute la rétine. La macula est normale chez 13 patients, atrophiée chez 10 et avec un oedème chez trois. Le Champ visuelle, lorsqu'il a été pratiqué, a montré une atteinte périphérique chez tous les sujets atteints. Par ailleurs, L’ERG est altéré en mode photopique et scotopique, ce qui est en faveur d’une dégénérescence des cônes et des bâtonnets. La recherche de la mutation R91W (325C>T) a montré que sa fréquence allélique est de 2.12% (2/94). Elle a été identifiée à l’état hétérozygote chez une fratrie (un garçon et une fille), originaire de Nabeul et issue d’un mariage non consanguin (Figures 2 et 3). Depuis leur naissance, ils manifestaient un nystagmus. A l’âge de 2 ans, le propositus présentait une malvoyance importante. A l’âge de 15 ans, son AV était inférieure à 1/10 et au bout de 2 ans, elle a chuté à «Voit Bouger La Main» (VBLM). De même pour sa soeur, âgée de 7 ans, son AV ne dépassait pas 1/10 et au bout de 2 ans, elle a diminué à «Compter Les Doigts» à 50 cm (CLD). Les deux patients présentaient une myopie bilatérale (-2.5 et -3.5) mais pas de cataracte ni d’anomalies du segment antérieur ni d’anomalies systémiques. Leurs fonds d’yeux ont montré une pâleur papillaire, des tâches blanchâtres en périphérie, une atrophie chorio-rétinienne et une macula normale (figure 1). L’ERG, réalisé à l’âge de 6 ans chez le propositus et à 7 ans  chez sa soeur, est plat en modes photopique et scotopique.

Figure 1 : Photos fond d’yeux: Une rétinopathie pigmentaire avec un rétrécissement vasculaire, une pâleur papillaire et une atrophie rétinienne surtout en pole postérieur et en périphérie, A et B: Absence de pigments rétiniens: présence de tâches blanchâtres, C: Présence de migrations pigmentaires en ostéoblastes, D: Présence de migrations pigmentaires en mottes.

Figure 2 : Electrophorégrammes de la séquence nucléotidique, exon 4 du gène RPE65; A séquence sauvage homozygote C/C, la flèche indique la base azotée Cytosine (C); B séquence hétérozygote C/T, la flèche indique la mutation 325C>T (R91W).

Figure 3 : Profil de migration sur gel d’agarose 2%. Le produit amplifié de 432 pb est digéré par l’enzyme de restriction RSAI. Cette enzyme reconnait son site de restriction et clive l’amplicon sauvage en deux fragments de taille 360 et 72 pb. L’amplicon de la séquence mutée n’est pas digérée. Puits 1, 3 et 4 : Patients porteurs de la mutation R19 W à l’état hétérozygote. Puits 2, 5 , 7 - 12 : patients homozygotes pour la séquence sauvage. Puits 6 : produit de PCR. Puits 13 : marqueur de taille 1 kb.

DISCUSSION
Tous nos patients, quel que soit leurs origines géographiques, présentaient des formes sévères de dystrophie rétinienne. La perte visuelle chez les patients avec une EORD était plus sévère que chez les RP à début précoce. De plus, chez la plupart des patients à bas âge, la rétine était apigmentaire et la pigmentation se manifestait de plus en plus avec l’âge. Des études antérieures ont montré que l’AV moyenne des ACL varie entre 20/100 à l’absence de la perception
lumineuse [18-20]. Parmi les 12 familles originaires de Nabeul, la mutation R91W n’a été identifiée qu’à l’état hétérozygote chez seulement deux enfants de la
même fratrie. Néanmoins, une étude chez trois familles Tunisiennes (11 malades) de la même région a suggéré que cette mutation, rapportée à l’état homozygote, est endémique. Tous ces patients présentaient une cécité nocturne congénitale et un ERG plat mais pas de photophobie ni d’atteintes systémiques. Ils gardent une vision centrale utile durant la première décade mais ils la perdent progressivement durant l’adolescence jusqu’au une vision qui variait entre compter les doigts à une perception lumineuse négative à partir de la troisième décade. Le fond d’oeil avait deux aspects, l’un se manifestait par des dépôts blanchâtres à la moyenne périphérie à des âges précoces et l’autre par des pigmentations en mottes à la moyenne périphérie à des âges plus tardifs [17]. Au cours de leur première décade, nos patients hétérozygotes, avaient une atteinte visuelle plus sévère que ceux rapporté par El Matri et al. Cette sévérité peut être due à la nature de la deuxième
mutation. Lorenz et al. ont montré la présence d’un retard psychomoteur modéré chez une fratrie atteinte de EORD et ceci est due à l’état hétérozygote composite de la R91W et la Y368H [21]. Toutefois, nos patients ne présentaient pas d’atteintes systémiques associées à l’atteinte visuelle. Des études antérieures ont rapporté
que la R91W a été identifiée soit à l’état homozygote ou associée avec d’autres mutations comme la Y368H, la M1T, la T162P, la R44Q, la 1059_1060 ins 1 pb, la V452G et la Q102K. Le phénotype est sévère avec une atteinte visuelle bilatérale, un nystagmus et une hespéranopie dés la naissance mais pas de photophobie [8,17,21-23].

CONCLUSION
Tous nos patients présentaient des formes sévères de dystrophie rétinienne avec une évolution rapide jusqu’à une perte de l’acuité visuelle. La mutation R91W (325C>T) n’est pas la cause majeure de l’EORD et de la RP à âge de début précoce dans la région de Nabeul et en Tunisie. L’absence de cette mutation n’exclut pas l’implication d’autres dans le gène RPE65.

Remerciements
Les auteurs tiennent à remercier les patients et leurs familles pour leurs participations à cette étude. Ils remercient également Pr. Yosr GORGI, Dr. Imène SFAR et Mlle Imène HABIBI, membres du laboratoire d’immunologie, CHU Charles Nicolle de Tunis pour leur assistance technique. Le Ministère de l’Enseignement Supérieur et de la Recherche Scientifique, Tunisie a financé cette étude.

 

 

Références
  1. Hamel C. Retinitis pigmentosa. Orphanet. J. Rare Dis. 2006;11:40.
  2. Hartong DT, Berson EL, Dryja TP. Retinitis pigmentosa. Lancet 2006;368: 1795-1809.
  3. Dollfus H, Duffier JL. Rétinopathies pigmentaires et principaux syndromes associés. OEil et génétique: Rapport de la société française d’ophtalmologie. Masson 2005;243-260
  4. Foxman SG, Heckenlively JR, Bateman JB, Wirtschafter JD. Retinitis Pigmentosa Classification of Congenital and Early Onset. Arch Ophthalmol 1985; 103:1502-6.
  5. Bonneau D, Kaplan J, Girard G, Dufier JL. Autosomal inheritance of "senile" retinitis pigmentosa. A report of a family with consanguinity. Clin Genet 1992;42:199-200.
  6. Daiger SP, Bowne SJ, Sullivan LS. Perspective on genes and mutations causing retinitis pigmentosa. Arch Ophthalmol 2007;125 :151-58.
  7. RetNet «Retinal Information Network» https://sph.uth.edu/Retnet/sumdis. htm#B-diseases, Accès le 06 Octobre 2013, dernière mise à jour le 27 September 2013
  8. Thompson Da, Gyürüs P, Fleischer LL et al. Genetics and Phenotypes of RPE65 Mutations in inherited retinal degeneration. Invest Ophthalmol Vis Sci 2000;41:4293-9.
  9. Hanein S, Perrault I, Gerber S et al. Leber congenital amaurosis: comprehensive survey of the genetic heterogeneity, refinement of the clinical definition, and genotype-phenotype correlations as a strategy for molecular diagnosis. Hum Mutat 2004;23:306-17.
  10. Nicoletti A, Wong DJ, Kawase K et al. Molecular characterization of the human gene encoding an abundant 61 kDa protein specific to the retinal pigment epithelium. Hum Mol Genet 1995;4:641-9.
  11. Acland GM, Aguirre GD, Bennett J et al. Long-term restoration of rod and cone vision by single dose rAAV-mediated gene transfer to the retina in a canine model of childhood blindness. Mol Ther 2005;12:1072–82.
  12. Bemelmans AP, Kostic C, Crippa SV et al. Lentiviral gene transfer of RPE65 rescues survival and function of cones in a mouse model of Leber congenital amaurosis. PLoS Med 2006;3:e347.
  13. Stein L, Roy K, Lei L, Kaushal S. Clinical gene therapy for the treatment of RPE65-associated Leber congenital amaurosis. Expert Opin Biol Ther 2011;11:429-39.
  14. Bennett J, Ashtari M, Wellman J et al. AAV2 gene therapy readministration in three adults with congenital blindness. Sci Transl Med 2012;4:1-10.
  15. Jacobson SG, Cideciyan AV, Ratnakaram R et al. Gene therapy for leber congenital amaurosis caused by RPE65 mutations: safety and efficacy in 15 children and adults followed up to 3 years. Arch Ophthalmol 2012;130:9-24.
  16. Mowat FM, Breuwer AR, Bartoe JT et al. RPE65 gene therapy slows cone loss in Rpe65-deficient dogs. Gene Ther 2013;20:545-55.
  17. El Matri L, Ambresin A, Schorderet DF et al. Phenotype of three consanguineous Tunisian families with early-onset retinal degeneration caused by an R91W homozygous mutation in the RPE65 gene Graefes Arch Clin Exp Ophthalmol. 2006;244:1104-12.
  18. Heher KL, Traboulsi EI, Maumenee IH. The natural history of Leber's congenital amaurosis. Age-related findings in 35 patients. Ophthalmology 1992;99:241-5.
  19. Fulton AB, Hansen RM, Mayer DL. Vision in Leber congenital amaurosis. Arch Ophthalmol 1996;114:698-703.
  20. Perrault I, Rozet JM, Ghazi I et al. Different Functional Outcome of RetGC1 and RPE65 Gene Mutations in Leber Congenital Amaurosis. Am J Humn Genet 1999;64:1225-8.
  21. Lorenz B, Gyürüs P, Preising M et al. Early-onset severe rod-cone dystrophy in young children with RPE65 mutations. Invest Ophthalmol Vis Sci 2000;41:2735-42.
  22. Morimura H, Fishman GA, Grover SA, Fulton AB, Berson EL, Dryja TP. Mutations in the RPE65 gene in patients with autosomal recessive retinitis pigmentosa or Leber congenital amaurosis. Proc Natl Acad Sci USA 1998;95:3088-93.
  23. Walia S, Fishman GA, Jacobson SG et al. Visual Acuity in Patients with Leber’s Congenital Amaurosis and Early Childhood-Onset Retinitis Pigmentosa. Ophthalmology 2010;117:1190-1198.
Espace membre
E-mail :
Mot passe :
Mémoriser Mot de passe oublié S'inscrire
Archives
2020
Janvier
Février
Mars
Avril
Mai
Juin
Juillet
Août
Septembre
Octobre
Novembre
Décembre
Mots-clés
Enfant traitement pronostic Chirurgie diagnostic Tunisie Maladie de crohn Cancer Cancer du sein dépistage Coelioscopie Immunohistochimie mammographie échographie Mortalité
Newsletter
S'inscrire pour recevoir les newsletters
E-mail :
Partagez
Rejoignez-nous !